View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_34 (Length: 315)
Name: NF6339_high_34
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 269
Target Start/End: Complemental strand, 40522878 - 40522620
Alignment:
| Q |
11 |
cacagatgcaatataaccaggaaccactattgcagcaccttgttttagttattttccnnnnnnnnnnctctctaccttagctgtacaaactattagccaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||| |||||| |
|
|
| T |
40522878 |
cacagatgcaatataaccaggaaccactattccagcaccttgttttagttattttccatttttttt-ctctctaccttatctgtacaaactatgagccaa |
40522780 |
T |
|
| Q |
111 |
tcaactatttggattt-ggctcatcaccatcttaattgaaacacaagtatggctagtttgtttcatgttagttaagatgaatgatttatacacctaaaat |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40522779 |
tcaactatttggattttggctcatcaccatcttaattgaaacacaagtatggctagtttgtttcatgttagttaagatgaatgatttatacacctaaaat |
40522680 |
T |
|
| Q |
210 |
taattaagattttgaatgtagttgtaattccttgaatttttgtgtggtcttggtcattag |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40522679 |
taattaagattttgaatgtagttgtaattccttgaatttttgtgtggtcttggtcattag |
40522620 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University