View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6339_high_36 (Length: 300)

Name: NF6339_high_36
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6339_high_36
NF6339_high_36
[»] chr8 (1 HSPs)
chr8 (19-226)||(5663527-5663734)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 5663527 - 5663734
Alignment:
19 gattggtctgctattactactggtggcgatgaaaggacgttggagtttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaataggttt 118  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| ||||||    
5663527 gattggtctgctattactacgggtggcgatgaaaggacgttggagtttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacaggttt 5663626  T
119 attctattgtacttgatttatttctaattgtttttatgctactgttgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctgtatact 218  Q
    |||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |    
5663627 attctattgtccttgatttatttctaatggtttttatgctactgttgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgtatatt 5663726  T
219 gttaattg 226  Q
     |||||||    
5663727 tttaattg 5663734  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University