View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_46 (Length: 249)
Name: NF6339_high_46
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_46 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 1 - 151
Target Start/End: Original strand, 51756493 - 51756647
Alignment:
| Q |
1 |
ataaaattaatattccatattcaagtatcagaaaataaattaagtgtcaaagttggtaatgaattgaagagtgaaatgaaattgtgttgtgctat----g |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
51756493 |
ataaaattaatattccatattcaagtatcagaaaataaattaagtgtcaaagttggtaatgaattgaagagtgaaatgaaattgtgttgtgctatgtacg |
51756592 |
T |
 |
| Q |
97 |
tagtagataaaccactgataatctcaaatgtccaggagatatagatgtgttcatt |
151 |
Q |
| |
|
|| ||||||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51756593 |
taatagataaaccactgaatatctcaaatgttcaggagatatagatgtgttcatt |
51756647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University