View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_47 (Length: 248)
Name: NF6339_high_47
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 73; Significance: 2e-33; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 160 - 232
Target Start/End: Complemental strand, 52853759 - 52853687
Alignment:
| Q |
160 |
gccatgggatagaatgtgctctagggacagttcagggcatcttgttcaagcattgacaaacggacaatatata |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52853759 |
gccatgggatagaatgtgctctagggacagttcagggcatcttgttcaagcattgacaaacggacaatatata |
52853687 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 61; Significance: 3e-26; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 48491053 - 48490977
Alignment:
| Q |
144 |
aagtttgataatccttgccatgggatagaatgtgctctagggacagttcagggcatcttgttcaagcattgacaaac |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48491053 |
aagtttgataacccttgccatgggatagaaggtgctccagggacggttcagggcatcttgttcaagcattgacaaac |
48490977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 98 - 144
Target Start/End: Complemental strand, 48483535 - 48483489
Alignment:
| Q |
98 |
attattctccatgagtcatttagcctgggaagatgtaatttaatgga |
144 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
48483535 |
attattctccacgagtcatttagtctcggaagatgtaatttaatgga |
48483489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University