View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_48 (Length: 246)
Name: NF6339_high_48
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 19 - 230
Target Start/End: Complemental strand, 10253371 - 10253160
Alignment:
| Q |
19 |
catttcacaagctcgtgtgcaagttgggtttgataaatatttattcccctacttgaaggggtatcacaacgatgacttgataaataatcttgtaccgtga |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
10253371 |
catttcacaagctcgtgtgcaagttgggtttgataaatatttattcccctacttgaaggggtatcacaaatattacttgataaataatcttgtaccgtga |
10253272 |
T |
|
| Q |
119 |
tcattattcacaaaatcagaaaatgagagagcttcttctcaccatttatccaataattaatcttgatgttcacttcatcaataacaacacacagagagca |
218 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
10253271 |
tcattattcacaaaatcagaaaaggagaaagcttcttctcaccatttatccaataattaatcttgatgttcacttcatcaataacaacacacagagagta |
10253172 |
T |
|
| Q |
219 |
ccaagtcatatt |
230 |
Q |
| |
|
|||||||||||| |
|
|
| T |
10253171 |
ccaagtcatatt |
10253160 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 20 - 87
Target Start/End: Complemental strand, 10266155 - 10266089
Alignment:
| Q |
20 |
atttcacaagctcgtgtgcaagttgggtttgataaatatttattcccctacttgaaggggtatcacaa |
87 |
Q |
| |
|
||||||| |||||||| || |||||| |||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
10266155 |
atttcacttgctcgtgtccatgttgggcttgataaatatttattccccaacttg-agggttatcacaa |
10266089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University