View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_53 (Length: 244)
Name: NF6339_high_53
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 3342916 - 3342691
Alignment:
| Q |
1 |
atgaaacaattgtgcatttctattttccaaaagatgtttgatgaaaagtttaaataccctttttatgctcaaatttggaactgattcaaaaactttgaga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3342916 |
atgaaacaattgtgcatttctattttccaaatgttgtttgatgaaaagtttaaataccctttttatgctcaaatttggaactgattaaaaaactttgaga |
3342817 |
T |
 |
| Q |
101 |
ttatcaataactgataaattatattgagcctcccatagaatgcgttgccaccaaatcacagtaccctttaaactagacaatggattgttttaactagttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3342816 |
ttatcaataactgataaattatattgagcctcccatagaatgcgttgccaccaaatcaccgtaccctttaaactagacaatggattgttttaactagttg |
3342717 |
T |
 |
| Q |
201 |
agaagcatggtgttcaatgctgcaat |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
3342716 |
agaagcatggtgttcaatgctgcaat |
3342691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University