View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_67 (Length: 218)
Name: NF6339_high_67
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_67 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 11 - 200
Target Start/End: Original strand, 44365995 - 44366171
Alignment:
| Q |
11 |
agcaaaggtagaatattccgtttaatcattactattacaccttttcagtcttcatatcttgatatcttgcttgatttccgtggaaaactaactagtctta |
110 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
44365995 |
agcaaaggtagaatattccatttaatcattactattacaccttttcagtcttcatatcttgatatcctgcttgatttccgtggaaaactaactagtctta |
44366094 |
T |
 |
| Q |
111 |
tcaatgatattgactgtatcaggaaaaaacttgttcnnnnnnnntcaatgattgattgcactatgaagtcatttttatgtatgaatgttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44366095 |
tcaatgatattgactgtatcaggaaaaaa-------------aatcaatgattgattgcactatgaagtcatttttatgtatgaatgttt |
44366171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University