View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_high_70 (Length: 202)
Name: NF6339_high_70
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_high_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 187
Target Start/End: Original strand, 42093600 - 42093769
Alignment:
| Q |
18 |
gacacgttttgtatcaattttttgaactatgtttgttgacttgttgttgggaaggaaaatgataatggatggtctttgttaatcaacatttcattatgat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42093600 |
gacacgttttgtatcaattttttgaactatgtttgttgacttgttgttgggaaggaaaatgataatggatggtctttattaatcaacatttcattatgat |
42093699 |
T |
 |
| Q |
118 |
tgtaaatgaaattaatttcattctcatgtgcttacttaggtcattgaaattgataatggatggtctttgt |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
42093700 |
tgtaaatgaaattaatttcattctcatgtgcttacttagctcattgaaattgataatggatggtctttgt |
42093769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 3e-28
Query Start/End: Original strand, 14 - 97
Target Start/End: Original strand, 38946738 - 38946821
Alignment:
| Q |
14 |
cacagacacgttttgtatcaattttttgaactatgtttgttgacttgttgttgggaaggaaaatgataatggatggtctttgtt |
97 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
38946738 |
cacagatacattttgtatcaatcttttgaactatgattgttgacttgttgttgggaaggaaaatgataatggatggtctctgtt |
38946821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 72 - 112
Target Start/End: Original strand, 42093745 - 42093785
Alignment:
| Q |
72 |
gaaaatgataatggatggtctttgttaatcaacatttcatt |
112 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42093745 |
gaaattgataatggatggtctttgttaatcaacatatcatt |
42093785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University