View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_33 (Length: 319)
Name: NF6339_low_33
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_33 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 301
Target Start/End: Complemental strand, 44467734 - 44467435
Alignment:
| Q |
1 |
caaataaaatactgatttcatcttttgtagataaaggagatttgcagcttgttgttatggtcaccttgtaatcgcagttaccactccgtttagtctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467734 |
caaataaaatactgatttcatcttttgtagataaaggagatttgcagcttgttgctatggtcaccttgtaatcgcagttaccactccgtttagtctcatt |
44467635 |
T |
|
| Q |
101 |
ctgaaacatgcatgcatatataaccttttat--------------ttaaaatatgaaattaataataaatcattcatgcagtgactaaactaattaatta |
186 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
44467634 |
ctgaaacat----gcatatataaccttttatttaagatgcattaattaaaatatgaaattaataataaatcattcatccagtgactaaac-------ttt |
44467546 |
T |
|
| Q |
187 |
acagggaaaagggacattgaaaatctaaagatttacttgttgttgggtatgaataagcatggatgattggttcatttgaggttgagtgcgaatgatcaat |
286 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44467545 |
acagggaaaagggacattgaaaat----tgatttacttgttgttgggtatgaataagcatggatgattggttcatttgaggttgagtgcgaatgatcaat |
44467450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 221 - 299
Target Start/End: Complemental strand, 44474575 - 44474497
Alignment:
| Q |
221 |
acttgttgttgggtatgaataagcatggatgattggttcatttgaggttgagtgcgaatgatcaatgttggtgttgcat |
299 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||| |||||| |||| || ||||| ||||||||||| |
|
|
| T |
44474575 |
acttgttgttgggtatggttaagcatggaatattggttcatttgaagttgagagcgagagaccaatgatggtgttgcat |
44474497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University