View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_36 (Length: 300)
Name: NF6339_low_36
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 5663527 - 5663734
Alignment:
| Q |
19 |
gattggtctgctattactactggtggcgatgaaaggacgttggagtttgctagacttaaaatttgtatgtttggcattgagtagaatccaaaataggttt |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |||| |||||| |
|
|
| T |
5663527 |
gattggtctgctattactacgggtggcgatgaaaggacgttggagtttgctagacttaaaatttttacgtttggcattgagtagaatcaaaaacaggttt |
5663626 |
T |
 |
| Q |
119 |
attctattgtacttgatttatttctaattgtttttatgctactgttgttgtgattttttatcaatgcagtcaattttcaatagagctgcttctgtatact |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5663627 |
attctattgtccttgatttatttctaatggtttttatgctactgttgttgtcattttttatcaatgcagtcaattttcaatagagctgcttctgtatatt |
5663726 |
T |
 |
| Q |
219 |
gttaattg |
226 |
Q |
| |
|
||||||| |
|
|
| T |
5663727 |
tttaattg |
5663734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University