View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_50 (Length: 245)
Name: NF6339_low_50
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 144; Significance: 8e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 20 - 171
Target Start/End: Complemental strand, 41343424 - 41343273
Alignment:
| Q |
20 |
ggtctaattccaaggccactaaactttactcagttcactccctctggttatgattcgtggctggtaagcaccaaccaagtaataaacaacattatatttt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41343424 |
ggtctaattccaaggccactaaactttactcagttcactccctctggttatgattcgtggctggtaagcaccaaccaagtaataaacaacattatatttt |
41343325 |
T |
 |
| Q |
120 |
atatttgtcatattattaagtgattgtttcacaccttaaccgatctcaactg |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41343324 |
atatttgtcatattattaagtgattgtttcacactgtaaccgatctcaactg |
41343273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 188 - 231
Target Start/End: Complemental strand, 41343273 - 41343230
Alignment:
| Q |
188 |
gcagatttgagatcggacagttcatatttcaaacagatgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
41343273 |
gcagatttgagatcggacagttcgtatttcaaacacatgatgtc |
41343230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University