View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_60 (Length: 233)
Name: NF6339_low_60
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_60 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 53 - 218
Target Start/End: Original strand, 35213188 - 35213349
Alignment:
| Q |
53 |
ggaaagattgagaacgagaaaccaaggagaaaaatctgcgtgctgccatgatagaaaaagattgttaccaacttaggctcagtggcattgttttgttcta |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213188 |
ggaaagattgagaacgagaaaccaaggagaaaaatctgcgtgctgccatgatagaaaaagattgttaccaacttaggctcagtggcattgttttgttcta |
35213287 |
T |
 |
| Q |
153 |
cttagtataaataattaagtattagtacaatatttttattttatttcaaaagaatgctgaatcatg |
218 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213288 |
cttagtataaa----taagtattagtacaatatttttattttatttcaaaagaatgctgaatcatg |
35213349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 14 - 53
Target Start/End: Original strand, 35213116 - 35213155
Alignment:
| Q |
14 |
cataggtgattagtgataattttctgtcacctaatgtatg |
53 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213116 |
cataggtgattagtgataattttctgtcacctaatgtatg |
35213155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University