View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_63 (Length: 227)
Name: NF6339_low_63
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_63 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 8 - 227
Target Start/End: Original strand, 28381854 - 28382067
Alignment:
| Q |
8 |
acaatcggcgaatacgcgaaataaaccggttgaccggttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccg |
107 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28381854 |
acaatcggcgaatacgcaaaataaaccggttgaccagttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccg |
28381953 |
T |
 |
| Q |
108 |
gtaacggttcatttacataccccatcgaataaccaccaccagcaccagcaacagcaacattatacatttctgaagtaaaggatgactgaaccgaaaccgg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28381954 |
gtaacggttcatttacataccccatcgaata------accagcaccagcaacagcaacattatacatttctgaagcaaaggatgactgaaccgaaaccgg |
28382047 |
T |
 |
| Q |
208 |
ttcaggtacctgaaccgaac |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
28382048 |
ttcaggtacctgaaccgaac |
28382067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 19 - 135
Target Start/End: Complemental strand, 28341879 - 28341763
Alignment:
| Q |
19 |
atacgcgaaataaaccggttgaccggttggtccagtaatcggcctcatagcttgatacaatccagaaggtgttggaatcaaataaaccggtaacggttca |
118 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||| || | ||||||||| ||||| |||||||| |||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
28341879 |
atacgcgaaataaaccggttcaccaattggtccggttaccggcctcattgcttggtacaatcctgaagatgttggaatcaaataaaccggtaacagttca |
28341780 |
T |
 |
| Q |
119 |
tttacataccccatcga |
135 |
Q |
| |
|
|| ||||||| |||| |
|
|
| T |
28341779 |
gttgaataccccgtcga |
28341763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University