View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6339_low_69 (Length: 210)
Name: NF6339_low_69
Description: NF6339
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6339_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 69 - 198
Target Start/End: Original strand, 33396424 - 33396553
Alignment:
| Q |
69 |
acattagtgagcacgtgacttcaaatcctcaattaaattgttaaaatcattgtaagaagatccaccaacctccacagctcttctagccatcttcccaaac |
168 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33396424 |
acattagtatgcacgtgacttcaaatcctcaattaaattgctaaaatcattgtaagaagatccaccaacctccacagctcttctagccattttcccaaac |
33396523 |
T |
|
| Q |
169 |
tcctttgctctgcttctcatttcctatgct |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
33396524 |
tcctttgctctgcttctcatttcctctgct |
33396553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University