View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6340_high_21 (Length: 270)
Name: NF6340_high_21
Description: NF6340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6340_high_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 18 - 249
Target Start/End: Complemental strand, 32775594 - 32775364
Alignment:
| Q |
18 |
atatgtttgcatgagactcaccacaagaatttgaggtttataatttagcccttgttgcttaattcttagaattaactcttcttccaaagccttgacttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32775594 |
atatgtttgcatgagactcaccacaagaatttgaggtttataatttagcccttgttgcttaattcttagaattaactcttcttccaaagccttgacttgg |
32775495 |
T |
 |
| Q |
118 |
tccaatatgtaaactacctgttgnnnnnnnggcaacaagtgttagaaaggaaaacaa-ttttgagccaaggtttttaagaaaaatctgcggctgagattt |
216 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32775494 |
tccaatatgtaaactacctgttgtttttttggcaacaagtgttagaaaggaaaacaatttttgagccaagg--tttaagaaaaatctgcggctgagattt |
32775397 |
T |
 |
| Q |
217 |
gggccgtgaaatattggtttctgatgtctctgc |
249 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
32775396 |
gggccgtgacatattggtttctgatgtctctgc |
32775364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University