View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6340_high_24 (Length: 251)
Name: NF6340_high_24
Description: NF6340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6340_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 20 - 239
Target Start/End: Complemental strand, 13275370 - 13275152
Alignment:
| Q |
20 |
ttctttattttgtttagaaacttttaattggtttagagccagctttgttattttctgtcaaagcatataaaccttcaaaagattaaggtttaaaatgatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13275370 |
ttctttattttgtttagaaacttttaattggtttagatccagctttgttattttctgtcaaagcatataaaccttcaaaagattaaggtttaaaatgatt |
13275271 |
T |
 |
| Q |
120 |
tgtaaacatgttatggatgtaatatacccttaaccctaaggaaactttaactcaaaactaaatttttgctcccttttttggtgcgtttcatgctgaaaaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
13275270 |
tgtaaacatgttatggatgtaatatacccttaaccctaaggaaactttaactcaaaactaaatttttgctccct-ttttcgtgcgtttcatgctgaaaaa |
13275172 |
T |
 |
| Q |
220 |
tttattataatctgcatatt |
239 |
Q |
| |
|
||| |||||||||||||||| |
|
|
| T |
13275171 |
tttcttataatctgcatatt |
13275152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University