View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6340_high_29 (Length: 228)
Name: NF6340_high_29
Description: NF6340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6340_high_29 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 32775145 - 32775372
Alignment:
| Q |
1 |
tagttatcttctcagttcatggttattttgggcaagcagatgttcttggcttgccagacactggtggccaggtaaaatttctaccataaggaacattaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32775145 |
tagttatcttctcagttcatggttattttgggcaagcagatgttcttggcttgccagacactggtggccaggtaaaatttctaccataaggaacattaat |
32775244 |
T |
|
| Q |
101 |
tttaattataagtatcaagtagtaaggttttaaattacggtcaatatgccaagattcctattgcatcgtgatccttaacattggagagaatgcggtgtaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32775245 |
tttaattataagtatcaagtagtaaggttttaaattgcggtcaatatgccaagattcctattgcatcgtgatccttaacattggagagaatgcggtgtaa |
32775344 |
T |
|
| Q |
201 |
tgcggccttagttgcagtcgcagagaca |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
32775345 |
tgcggccttagttgcagtcgcagagaca |
32775372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 6 - 83
Target Start/End: Complemental strand, 29120321 - 29120244
Alignment:
| Q |
6 |
atcttctcagttcatggttattttgggcaagcagatgttcttggcttgccagacactggtggccaggtaaaatttcta |
83 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||||||||||||| || || || ||||||| ||||||| |
|
|
| T |
29120321 |
atcttctctattcatggttattttggtcaagcagatgttcttggcttgccagataccggcggacaggtaacatttcta |
29120244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 17 - 74
Target Start/End: Original strand, 39398510 - 39398567
Alignment:
| Q |
17 |
tcatggttattttgggcaagcagatgttcttggcttgccagacactggtggccaggta |
74 |
Q |
| |
|
||||||||||||||||||||| |||| || || ||||| ||||||||||| |||||| |
|
|
| T |
39398510 |
tcatggttattttgggcaagccaatgtcctgggtttgcctgacactggtgggcaggta |
39398567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University