View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6340_low_16 (Length: 370)
Name: NF6340_low_16
Description: NF6340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6340_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 7 - 211
Target Start/End: Complemental strand, 7722953 - 7722749
Alignment:
| Q |
7 |
ggacccaatgcaataaatgaaatgaagggtaagtcagggagtgagtgtgtaatgtaagcaagtgtttgagtttctattatatctctgcagaattactact |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722953 |
ggacccaatgcaataaatgaaatgaagggtaagtcagggagtgagtgtgtaatgtaagcaagtgtttgagtttctattatatctctgcagaattactact |
7722854 |
T |
|
| Q |
107 |
gtttatgacacccttcatgtatgattttgatttcttcttgcataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaag |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722853 |
gtttatgacacccttcatgtatcattttgatttcttcttgaataatgcatagtttcaatttatactagtagaaagatcataaagataaagaaagagaaag |
7722754 |
T |
|
| Q |
207 |
agagg |
211 |
Q |
| |
|
||||| |
|
|
| T |
7722753 |
agagg |
7722749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 232 - 366
Target Start/End: Complemental strand, 7722723 - 7722589
Alignment:
| Q |
232 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722723 |
atgatgggttggtcaaaagagcccacgtgactagagggaacggtcttcaagggatctatctatctgcaaggtttttctccgatcacgaggctttattagt |
7722624 |
T |
|
| Q |
332 |
gtctcaaaaacctctgtccgtatccgtatctctgc |
366 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
7722623 |
gtctcaaaaacctctgtccgtatccgtatctctgc |
7722589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University