View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6340_low_36 (Length: 219)
Name: NF6340_low_36
Description: NF6340
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6340_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 15 - 204
Target Start/End: Complemental strand, 7653107 - 7652918
Alignment:
| Q |
15 |
catcacctctttcttttct-ccaacttcacaccctcaactaaactctcannnnnnnaattattctccacaccccacctccaataatgtcctcaccagaga |
113 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7653107 |
catcacctctttcttttcttccaacttcacaccctcaactaaactctcacccccc-aattattctccacaccccacctccaataatgtcctcaccagaga |
7653009 |
T |
 |
| Q |
114 |
atctccctctagaaaccgctcaaaaaatcatcctccgatgggactcaaccgcctccgaagaagctcgtgaaaaaatgatcttcgatcaaac |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7653008 |
atctccctctagaaaccgctcaaaaaatcatcctccgatgggactcaaccgcctccgaagaagctcgtgaaaaaatgatcttcgatcaaac |
7652918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University