View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6341_high_25 (Length: 227)

Name: NF6341_high_25
Description: NF6341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6341_high_25
NF6341_high_25
[»] chr2 (1 HSPs)
chr2 (1-221)||(37717480-37717700)


Alignment Details
Target: chr2 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 37717700 - 37717480
Alignment:
1 ctcgacctctaattcattgcacaagtatagagacataaccatcaaacaacgatcttttaattacgataaatcaaggttattaatgaattctactggggat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37717700 ctcgacctctaattcattgcacaagtatagagacataaccatcaaacaacgatcttttaattacgataaatcaaggttattaatgaattctactggggat 37717601  T
101 atacaattttggaggtggtatgacattcaatgggtgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagct 200  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37717600 atacaattttggaggtggtatgacattcaatggatgaacgagtggtcgcggccatcagacgtatgtgacagacataattattgtggtagctttagcagct 37717501  T
201 gcaacaaaaataattggatac 221  Q
    |||||||||||||||||||||    
37717500 gcaacaaaaataattggatac 37717480  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University