View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6341_high_4 (Length: 388)
Name: NF6341_high_4
Description: NF6341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6341_high_4 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 9e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 9e-86
Query Start/End: Original strand, 182 - 388
Target Start/End: Original strand, 5174657 - 5174872
Alignment:
| Q |
182 |
catatgtaaaatgaacatttatctaactcatg----catgttgcgtatgagaaaaaatacttgtatcatttgtacagtctcaattccaatattctctggt |
277 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174657 |
catatttaaaatgaacatttatctaactcatgcatgcatgttgcgtatgagaaaaaatacttgtatcatttgtacagtctcaattccaatattctctggt |
5174756 |
T |
 |
| Q |
278 |
ttctcag-atctttgtttattatgttaaaaaacacaaatcat-aatctgcatgaatccggcagagtag---tgatggtaggagaaacatagccataggag |
372 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5174757 |
ttctcagaatctttgtttcttatgttaaaaaacacaaatcataaatctgcatgaatccggcagagtagatttgatggtaggagaaacatagccataggag |
5174856 |
T |
 |
| Q |
373 |
ttaaaaatatatactt |
388 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
5174857 |
ttaaaaatatatactt |
5174872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 46 - 92
Target Start/End: Original strand, 5174604 - 5174650
Alignment:
| Q |
46 |
agataagatatgttgctgttaataattggagcaagtagacaataata |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5174604 |
agataagatatgttgctgttaataattggagcaagtagacaataata |
5174650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University