View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6341_low_2 (Length: 583)
Name: NF6341_low_2
Description: NF6341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6341_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 565; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 565; E-Value: 0
Query Start/End: Original strand, 1 - 573
Target Start/End: Complemental strand, 48501432 - 48500860
Alignment:
| Q |
1 |
agaatctctctccattttcttcaaccttgttttcaccattcgtctcttttggttatgcgcttgcgacgcgcctagcgaagcaggttcactctatttccac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501432 |
agaatctctctccattttcttcaaccttgttttcaccattcgtctcttttggctatgtgcttgcgacgcgcctagcgaagcaggttcactctatttccac |
48501333 |
T |
|
| Q |
101 |
tcgttactcgctccggttctagaaactgcgttgtcaaagaaactagcttcggtgctaagaaccttctttattaccgtaggtgtagacactgaactctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501332 |
tcgttactcgctccggttctagaaactgcgttgtcaaagaaactagcttcggtgctaagaaccttctttattaccgtaggtgtagacactgaactctgtt |
48501233 |
T |
|
| Q |
201 |
tcatgcgcacccttgggtacataatagcaaaatggtgcattataagagaattgggtgtaggattacaaacactcgtgccatcgaatccgaaattctctta |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501232 |
tcatgcgcacccttgggtacataatagcaaaatggtgcattataagagaattgggtgtaggattacaaacactcgtgccatcgaatccgaaattctctta |
48501133 |
T |
|
| Q |
301 |
cgcgacggagtctcatggtttttggattctgaaaggctacgcgccggttatgacgatgaaactggcgagaaactatgggcaaaatggtaaatttcaaggt |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501132 |
cgcgacggagtctcatggtttttggattctgaaaggctacgcgccggttatgacgatgaaactggcgagaaactatgggcaaaatggtaaatttcaaggt |
48501033 |
T |
|
| Q |
401 |
attgatgctaaggagtcaataatcaggtacggtctagctcaccaccaattggaagcacacgtgcagttggaatatacagttggattttatgatggattca |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48501032 |
attgatgctaaggagtcaataatcaggtacggtctagctcaccaccaattggaagcacacgtgcagttggaatatacagttggattttatgatggattca |
48500933 |
T |
|
| Q |
501 |
ttcgggttaatacacgtgttgataatatgcgtctccatgtggcgaggttaggttttaaacacggtgatgatgt |
573 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48500932 |
ttcgggttaatacacgtgttgataatatgcgtctccatgtggcgaggttaggttttaaacacggtgatgatgt |
48500860 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University