View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6341_low_22 (Length: 247)
Name: NF6341_low_22
Description: NF6341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6341_low_22 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 18 - 247
Target Start/End: Original strand, 39087907 - 39088139
Alignment:
| Q |
18 |
tatccattgatctactttgctctgttgttgtgagttttgattcattgttgaatgaatcattatttggtgttgaatgtttggaatgnnnnnnnggttgcct |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
39087907 |
tatccattgatctactttgctctgttgttgtgagttttgattcattgttgaatgaatcattatttggtgttgaatgtttcgaatgtttttttggttgcct |
39088006 |
T |
 |
| Q |
118 |
tggtttgtctgatttttcctttgcatgtgactctctaatgtttcc---tgatgaatgtgagtgttgcttagatgatttaggcaagggcaactcatttgtg |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39088007 |
tggtttgtctgatttttcctttgcatgtgactctctaatgtttcctgatgatgaatgtgagtgttgcttagatgatttaggcaagggcaactcatttgtg |
39088106 |
T |
 |
| Q |
215 |
tcctcttcaacattcactgatcttgaacctttt |
247 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
39088107 |
tcctcttcaacattcactgaccttgaacctttt |
39088139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University