View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6341_low_24 (Length: 244)
Name: NF6341_low_24
Description: NF6341
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6341_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 187
Target Start/End: Original strand, 46724749 - 46724921
Alignment:
| Q |
20 |
tgagattaggaagtttttcaaagcagtttctgtttcatttcaaagctatggaatctggatcaaagaattagaaagaagggaacagcatcatg-----gca |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
46724749 |
tgagattaggaagtttttcaaagcagtttctgtttcatttcaaagctatggaatctggatcaaagaattagaaagaagggaacagcatcatggcatggca |
46724848 |
T |
|
| Q |
115 |
tggcatcggggacagtgtcaagtgcagtctctttctttctactttaacagcattacttaacccttttgtcaac |
187 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46724849 |
tggcatgggggacagtgtcaagtgcagtctctttctttctactttaacagcattacttaacctttttgtcaac |
46724921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 203 - 240
Target Start/End: Original strand, 46724942 - 46724979
Alignment:
| Q |
203 |
ttgcttaacccaatttaatccattcaaaaattaatctt |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46724942 |
ttgcttaacccaatttaatccattcaaaaattaatctt |
46724979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University