View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6342_low_2 (Length: 308)
Name: NF6342_low_2
Description: NF6342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6342_low_2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 145 - 295
Target Start/End: Original strand, 38893384 - 38893536
Alignment:
| Q |
145 |
tcttttgtatctttgatgtaatcatgtattgattttttgagtgtgattccaaattaaggaaccactt--tgtgtgtttggttcgcgtctcaatgtaaata |
242 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
38893384 |
tcttttgtatctttgatgtagtcatgtattgattttttgagtgtgattccaaattaaggaaccacttagtgtgtgtttggttcgcgtctcaatgtaaata |
38893483 |
T |
|
| Q |
243 |
ttgtcgcgactttaagaagctataaaacttaaacttatgcgttaacatgaatt |
295 |
Q |
| |
|
|| |||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38893484 |
ttatcgcgactttgagaagctataaaacttaaactcatgcgttaacatgaatt |
38893536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 18 - 147
Target Start/End: Original strand, 38893220 - 38893347
Alignment:
| Q |
18 |
ggtgtgctagtgataattgtcttaattatttgatcagagtgtatttgattatgnnnnnnntatattgagagaaattaacctgtagataaatcttattata |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38893220 |
ggtgtgctagtgataattgtcttaattatttgatcagagtgtatttgattatgaaaaa--tatattgagagaaattaacctgtagataaatcttattata |
38893317 |
T |
|
| Q |
118 |
tttttagatttgcctttaaagtacaattct |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
38893318 |
tttttagatttgcctttaaagtacaattct |
38893347 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University