View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6342_low_3 (Length: 228)
Name: NF6342_low_3
Description: NF6342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6342_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 17 - 213
Target Start/End: Original strand, 28560436 - 28560627
Alignment:
| Q |
17 |
atgttcatgctcatcacgcatacatgcggaaactcatgttattgctgtttactttctgctccccaatgtagtaagtgtggtatgcttctaatgcatactt |
116 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
28560436 |
atgttcatgctcatcacgcatacatgtggaaactcatgttattgctgtttactttctgctccccaatgtaataagtgtggtatgcttcaaatgcatactt |
28560535 |
T |
 |
| Q |
117 |
gtggaaacacatcgtgtgcnnnnnnnnnnctcttcttcttttatctttaataactttcaacacatcaatataagatgtgcgtgtgtgttagtttctt |
213 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28560536 |
gtggaaacacatcgtgtgcttttttttt--tcttcttcttgtatc---aataactttcaacacatcaatataagatgtgcgtgtgtgttagtttctt |
28560627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University