View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6342_low_4 (Length: 212)
Name: NF6342_low_4
Description: NF6342
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6342_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 35805921 - 35805761
Alignment:
| Q |
1 |
aaatcacaccaccaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttgtaaatt |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35805921 |
aaatcataccaccaccatcaaaattgtgataaatataaatctccaccacgcaattgcatatgaatttattaatgtaaattaagaggctagtttgtaaatt |
35805822 |
T |
|
| Q |
101 |
aagaggctagttagaattgaagttaaacaacaccacttgctggccttgtccacaacatgaa |
161 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35805821 |
aagaggctagttagaattgaagtgaaacaacaccacttgttggccttgtccacaacatgaa |
35805761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University