View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6343_high_11 (Length: 305)
Name: NF6343_high_11
Description: NF6343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6343_high_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 7 - 233
Target Start/End: Complemental strand, 1819827 - 1819602
Alignment:
| Q |
7 |
ggagcacagaggtttgatgttggtttgcaatatagttgtttgggttatttggaagactaaaattcattggnnnnnnngggagaaaaaatattcgatcgtc |
106 |
Q |
| |
|
|||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||||||||| ||||| |
|
|
| T |
1819827 |
ggagcacaaaggtttgatgttggtttggcgtatagttgtttgggttatttggaagactaaaattgattgattttttttggagaaaaaatattcggtcgtc |
1819728 |
T |
|
| Q |
107 |
gagggggtagactatatacaacatgtctcttggcaatggttattggcaaagaagaaaagggcaccatgcttattttatgagtggtttggtgcatcctaaa |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||||||||||||| |
|
|
| T |
1819727 |
gagggggtagactatatacaacatgtctcttggcaatggttattggcaaagaagaaaagggcaccatgcttgttttatgagt-gattggtgcatcctaaa |
1819629 |
T |
|
| Q |
207 |
gattgtatgttgagaagttaatatgtg |
233 |
Q |
| |
|
|||||||||||||||||||||| |||| |
|
|
| T |
1819628 |
gattgtatgttgagaagttaatttgtg |
1819602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University