View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6343_high_13 (Length: 285)
Name: NF6343_high_13
Description: NF6343
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6343_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 7 - 257
Target Start/End: Original strand, 38012375 - 38012615
Alignment:
| Q |
7 |
gcagcagagatcgaaccctaaacctccatcttaaactctttccctttcttcaaatgggtaagtttcattcatccctaaattcatgattgtgtcctttgag |
106 |
Q |
| |
|
|||||| |||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
38012375 |
gcagcaaagatcgaaccctgaacctccatcttaaactcttt----------aaatgggtaagtttcattcatccccaaattcatgattgtgtcctttgag |
38012464 |
T |
 |
| Q |
107 |
tgtagtttctttttagttcttgattttatccattgaaaagagggaaattaatgattttatcaatcgttaaatgttaaccattataggttagaaatgacta |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38012465 |
tatagtttctttttagttcttgattttatccattgaaaagagggaaattaatgattttatcaatcgttaaatgttaaccattataggttagaaatgacta |
38012564 |
T |
 |
| Q |
207 |
aagttaaacaatgcttgtaatctaatagttataattgatttatatgatttt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38012565 |
aagttaaacaatgcttgtaatctaatagttataattgatttatatgatttt |
38012615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University