View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6345_high_6 (Length: 270)
Name: NF6345_high_6
Description: NF6345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6345_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 92
Target Start/End: Complemental strand, 22191102 - 22191029
Alignment:
| Q |
19 |
ataaacctattcatagtttatataatttattttctttgagagtacgttcctcagtgaaggtgaatcaataacaa |
92 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
22191102 |
ataaacctattgatagtttatataatttattttctttgagagtaaggtcctcagtgaaggtgaatcaataacaa |
22191029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University