View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6345_high_9 (Length: 254)
Name: NF6345_high_9
Description: NF6345
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6345_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 229
Target Start/End: Original strand, 26838304 - 26838515
Alignment:
| Q |
18 |
gttatcagttataacttaattacaaaaaagtttatgtaaaactgttagatatagttttctggctcattcataggaagtttacattttcatagtactacta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26838304 |
gttatcagttataacttaattacaaaaaagtttatgtaaaactgttagatatagttttttggctcattcataggaagtttacattttcatagtactacta |
26838403 |
T |
 |
| Q |
118 |
taggtaaattcttcccnnnnnnnnnnnnggctctaccgaaaaatcaatgtaatcattgaagaaggttaagaaaaatgatgtgtatcgagtattctgtcag |
217 |
Q |
| |
|
|||||| ||||||||| ||||||||| |||||||| |||||||||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
26838404 |
taggtagattcttcccttttttatttttggctctaccaaaaaatcactgtaatcattgaagaaggttgagaaaaataatgtgtatcgagtattctgtcag |
26838503 |
T |
 |
| Q |
218 |
atttacccatga |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
26838504 |
atttacccatga |
26838515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University