View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6346_high_3 (Length: 237)
Name: NF6346_high_3
Description: NF6346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6346_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 14 - 222
Target Start/End: Original strand, 49930302 - 49930510
Alignment:
| Q |
14 |
aaagctagaaagaatccctcaaccagtattcttttgcaagtttgagattcaatatttggcatctttaaattttcaacgaactgcaagtatgaatgcatgc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
49930302 |
aaagctagaaagaatccctcaaccagtattcttttgcaagtttgagattcaatatttggcatctttaaattttcaacaaactgcaagtatgaaagcatgc |
49930401 |
T |
 |
| Q |
114 |
atcaaaaacatgttattaagtaacttttgtccaaaccaatattagaaagaatccaagacaatttacatgggaaaatggaactatccatcatttgttgtat |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49930402 |
atcaaaaacatgttattaagtaacttttgtccaaaccaatattagaaagaatccaagacaatttatatgggaaaatggaactatccatcatttgttgtat |
49930501 |
T |
 |
| Q |
214 |
ggattttct |
222 |
Q |
| |
|
||| ||||| |
|
|
| T |
49930502 |
ggactttct |
49930510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University