View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6346_high_4 (Length: 222)
Name: NF6346_high_4
Description: NF6346
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6346_high_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 62; Significance: 6e-27; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 129 - 206
Target Start/End: Complemental strand, 32869038 - 32868961
Alignment:
| Q |
129 |
ggtggcgatgatggcggacgtcttggtagaaaagcattagaccgcgatagaaaagcacaaggcagatgtccttgttgc |
206 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
32869038 |
ggtggtgatgatggcagacgtcttggtagaaaagcattagaccgcgatagaaaaggacgaggcagatgtccttgttgc |
32868961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 24 - 83
Target Start/End: Complemental strand, 32869092 - 32869030
Alignment:
| Q |
24 |
agcaatgatggaggtgacagacttcct---gattgagaaccatcaggagatgatggtggtgat |
83 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32869092 |
agcaatgatggaggtgacagacttcctcctgattgagaaccatcaggagatgatggtggtgat |
32869030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University