View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6347_high_10 (Length: 237)
Name: NF6347_high_10
Description: NF6347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6347_high_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 72 - 221
Target Start/End: Complemental strand, 39027003 - 39026854
Alignment:
| Q |
72 |
atgcaataataccttttctaggtttttcttgtttcctgcattcaaatgagcaaaaccttcatcatttgcagtatcagatgtagatgtaatattctgattt |
171 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
39027003 |
atgcaataataccttttctagatttttcttgtttactgcattcaaatgagcagaaccttcatcatttgcagtatcagatgtagatgtagaattctgattt |
39026904 |
T |
|
| Q |
172 |
ccctccaagtccttactattactatttattactccagatatagatggatc |
221 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
39026903 |
ccctccaagtccttaccattaccatttattactccagatatagatggatc |
39026854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 78 - 158
Target Start/End: Complemental strand, 39031669 - 39031589
Alignment:
| Q |
78 |
taataccttttctaggtttttcttgtttcctgcattcaaatgagcaaaaccttcatcatttgcagtatcagatgtagatgt |
158 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||| ||||||||| || ||| |||||| |||||| |||||||||||| |
|
|
| T |
39031669 |
taataccttttctagatttttcttgtttactgcattgaaatgagcagaattttcgtcattttcagtattagatgtagatgt |
39031589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 1 - 73
Target Start/End: Complemental strand, 18185070 - 18184998
Alignment:
| Q |
1 |
attatgcatgatacatattatgctagataaataaaaacaaaaacagaatgaaaatgctataagagaatagcat |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18185070 |
attatgcatgatacatattatgctagataaataaaaacaaaaacagaatgaaaatgctataagaaaatagcat |
18184998 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University