View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6347_high_8 (Length: 241)
Name: NF6347_high_8
Description: NF6347
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6347_high_8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 18185288 - 18185068
Alignment:
| Q |
20 |
tttctttccctcataggggttacaactgaaaataaaatgtacccttcagatggagcaatcctgccctcggcatgttccatgtcattggccataagaaatc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18185288 |
tttctttccctcataggggttacaactgaaaataaaatgtacccttcggatggagcaatcctgccctcggcatgttccatgtcattggccataagaaatc |
18185189 |
T |
|
| Q |
120 |
aatcaacactcgaacctactgatatttcaaacagctacaatgatcaaaagcatgtgcgcgagagggttactttgacagaaacttatacatggatactaca |
219 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18185188 |
aatcaacactcgaacccactgatatttcaaacagctacaatgatcaaaagcatgtgcgcgagagggttac-ttgacagaaacttatacatggatactaca |
18185090 |
T |
|
| Q |
220 |
atgatcaaacaattaaaacatt |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
18185089 |
atgatcaaacaattaaaacatt |
18185068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University