View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6348_high_3 (Length: 280)
Name: NF6348_high_3
Description: NF6348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6348_high_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 17 - 270
Target Start/End: Original strand, 31337178 - 31337430
Alignment:
| Q |
17 |
caaattctgttcctttgtcacctatcaacttcttggagagagcagcaaaggtatgtagagacagaacatcacttgtttatggttctttgaagtataattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31337178 |
caaattctgttcctttgtcacctatcaacttcttggagagagcagcaaaggtttgtagagacagaacatcacttgtttatggttctttgaagtataattg |
31337277 |
T |
 |
| Q |
117 |
gggtcaaactcatcaacgttgtctcaaactcgcttctgctctctcccagttggggatttctcgtggagataaggtcagttctctctgtcatactatctat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31337278 |
gggtcaaactcatcaacgttgtctcaaactcgcttctgctctctcccagttggggatttctcgtggagataaggtcagttctctctgtcatactatctat |
31337377 |
T |
 |
| Q |
217 |
cattagagtaatagtaatgttttaggttttattttttcttcatgtttacctatg |
270 |
Q |
| |
|
||||||||| |||||||||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
31337378 |
cattagagttatagtaatgttttaggattt-ttttttcttcatgtttatctatg |
31337430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 31315130 - 31315299
Alignment:
| Q |
17 |
caaattctgttcctttgtcacctatcaacttcttggagagagcagcaaaggtatgtagagacagaacatcacttgtttatggttctttgaagtataattg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31315130 |
caaattctgttcctttgtcacctatcaacttcttggagagagcagcaaaggtttgtagagacagaacatcacttgtttatggttctttgaagtataattg |
31315229 |
T |
 |
| Q |
117 |
gggtcaaactcatcaacgttgtctcaaactcgcttctgctctctcccagttggggatttctcgtggagat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||| ||||||| |||||||| ||||||||| |
|
|
| T |
31315230 |
gggtcaaactcatcaacgttgtctcaaacttgcttcttctcttacccagttagggatttcccgtggagat |
31315299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University