View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6348_low_7 (Length: 237)
Name: NF6348_low_7
Description: NF6348
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6348_low_7 |
 |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0092 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 22391 - 22616
Alignment:
| Q |
1 |
catcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatccaacaaggaggtccatgaaaaccag |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22391 |
catcagagacaaaaattcaaagtcatgtacaagaggaagctatatcctcatggaaagtttgggaacctcctgatcgaacaaggaggtccatgaaaaccag |
22490 |
T |
 |
| Q |
101 |
gtgataaatagaggatgtttatttaccnnnnnnnnnnaggatttcttgctatgaaactatgtgattggtctaggtcaaactatttacattttatataggg |
200 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22491 |
gtgaaaaatagaggatgttt-tttactttttttttttaggatttcttgctatgaaactatgtgattggtctaggtccaactatttacattttatataggg |
22589 |
T |
 |
| Q |
201 |
attttatttaccatcactatgatgatg |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
22590 |
attttatttaccatcactatgatgatg |
22616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University