View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6349_high_12 (Length: 239)
Name: NF6349_high_12
Description: NF6349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6349_high_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 16 - 221
Target Start/End: Complemental strand, 44145055 - 44144850
Alignment:
| Q |
16 |
ataattctggactgtaaagaaatactgcagcacatgaattctaggactttggttttaaaatggtccagaccttgccatgaattgcatttgttatgactta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44145055 |
ataattctggactgtaaagaaatactgcagcacatgaattctaggactttggttgtaaaatggtccagaccttgccatgaattgcatttgttatgactta |
44144956 |
T |
|
| Q |
116 |
ttatgtctctaatgaaaatcttgttttcatgtcaaaaagaataaaataatcctcctattcgaagcttgcaagtgagtctaaatttgatggcattttttga |
215 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
44144955 |
ttatttctctaatgaaaatcttattttcatgtcaaaaaaattaaaataatcctcctattcgaaacttgcaagtgagtctaaatttgattgcattttttga |
44144856 |
T |
|
| Q |
216 |
ctataa |
221 |
Q |
| |
|
| |||| |
|
|
| T |
44144855 |
caataa |
44144850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 64
Target Start/End: Complemental strand, 40893439 - 40893411
Alignment:
| Q |
36 |
aatactgcagcacatgaattctaggactt |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40893439 |
aatactgcagcacatgaattctaggactt |
40893411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University