View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6349_low_11 (Length: 255)
Name: NF6349_low_11
Description: NF6349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6349_low_11 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 2 - 220
Target Start/End: Original strand, 28996480 - 28996706
Alignment:
| Q |
2 |
tcgagtgatatgaaataagaaggttttccgttccaacttcaaagtaagtcacatcttgttctgaggtattttctgctttgaggtgtatgcccttttcaac |
101 |
Q |
| |
|
||||||| || |||||||| ||||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28996480 |
tcgagtgctacgaaataaggaggtttttcgtttcaacttcaaagtaagtcacaccttgttctgaggtattttctgctttgaggtgtatgcccttttcaac |
28996579 |
T |
 |
| Q |
102 |
tttgtcctttataaaaggtcttgttgcattgaggagtacatattttatataaactactattgaccttgattcctaaacaacgtggggtgttt-------- |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28996580 |
tttgtcttttataaaaggtcttgttgcattgaggagtacacattttatataaattactattgaccttgattcctaaacaacgtggggtgttttagttgta |
28996679 |
T |
 |
| Q |
194 |
taccatagcagttggaattatgggtcc |
220 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
28996680 |
taccatagcagttggaattatgggtcc |
28996706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University