View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6351_high_12 (Length: 225)

Name: NF6351_high_12
Description: NF6351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6351_high_12
NF6351_high_12
[»] chr4 (1 HSPs)
chr4 (1-211)||(7728017-7728226)
[»] chr2 (1 HSPs)
chr2 (118-158)||(33535617-33535657)
[»] chr1 (1 HSPs)
chr1 (132-160)||(9550368-9550396)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 211
Target Start/End: Original strand, 7728017 - 7728226
Alignment:
1 tctgtgtc-tgtccggtgtccatgtctgtgttacgtagatattggatacaacattgacatcgataataatttaataaatgaaaaatagtttgtaactacg 99  Q
    |||||||| |||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||    
7728017 tctgtgtcgtgtccggtgtccatgtctgtgttacgtagatattgga--caacattgacatcgataataatttaataaatgaaaaatagtttgtaactacg 7728114  T
100 tgtgtcgggtgtctgattgaacaccgtgcacacctttaatctgaagtgttgatgctacatagcggttcttacttagcttctattgaagtaatagttttaa 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7728115 tgtgtcgggtgtctgattgaacaccgtgcacacctttaatctgaagtgttgatgctacatagcggttcttacttagcttctattgaagtaatagttttaa 7728214  T
200 gtgagattcatg 211  Q
    ||||||||||||    
7728215 gtgagattcatg 7728226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 33535657 - 33535617
Alignment:
118 gaacaccgtgcacacctttaatctgaagtgttgatgctaca 158  Q
    ||||||||  ||||||||||||||||||||| |||||||||    
33535657 gaacaccggacacacctttaatctgaagtgtcgatgctaca 33535617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 132 - 160
Target Start/End: Complemental strand, 9550396 - 9550368
Alignment:
132 cctttaatctgaagtgttgatgctacata 160  Q
    |||||||||||||||||||||||||||||    
9550396 cctttaatctgaagtgttgatgctacata 9550368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University