View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6351_high_13 (Length: 220)

Name: NF6351_high_13
Description: NF6351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6351_high_13
NF6351_high_13
[»] chr4 (2 HSPs)
chr4 (1-92)||(7727897-7727988)
chr4 (174-215)||(7727772-7727813)


Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 7727988 - 7727897
Alignment:
1 gattcagtataattataagtgtcggtgttaagtcactatcgaacaccaatgcgtgtctgtgcttcatagagaagcatgctaaatgactactt 92  Q
    ||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||    
7727988 gattcagtataattataggtgtcggtgttatgtcactatcgaacaccaacgcgtgtccgtgcttcatagagaagcatgctaaatgactactt 7727897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 7727813 - 7727772
Alignment:
174 cctgggtggttatgagtgaaggtatcccatatacttggccct 215  Q
    ||||||||||||||||||||||||||||||||||||||||||    
7727813 cctgggtggttatgagtgaaggtatcccatatacttggccct 7727772  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University