View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6351_high_13 (Length: 220)
Name: NF6351_high_13
Description: NF6351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6351_high_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 92
Target Start/End: Complemental strand, 7727988 - 7727897
Alignment:
| Q |
1 |
gattcagtataattataagtgtcggtgttaagtcactatcgaacaccaatgcgtgtctgtgcttcatagagaagcatgctaaatgactactt |
92 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7727988 |
gattcagtataattataggtgtcggtgttatgtcactatcgaacaccaacgcgtgtccgtgcttcatagagaagcatgctaaatgactactt |
7727897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 174 - 215
Target Start/End: Complemental strand, 7727813 - 7727772
Alignment:
| Q |
174 |
cctgggtggttatgagtgaaggtatcccatatacttggccct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7727813 |
cctgggtggttatgagtgaaggtatcccatatacttggccct |
7727772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University