View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6351_low_11 (Length: 298)
Name: NF6351_low_11
Description: NF6351
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6351_low_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 9 - 217
Target Start/End: Original strand, 31644960 - 31645168
Alignment:
| Q |
9 |
agcagagatacgatattctattgtttttgtttgattcaaaatatggctatgtgtgtatttattactcctgatagctactttttgagagccaagaatgaga |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31644960 |
agcaaagatacgatattctattgtttttgtttgattcaaaatatggctatgtgtgtatttattactcctgatagctactttttgagagccaagaatgaga |
31645059 |
T |
 |
| Q |
109 |
cttggatacacacaatgcaactaagaatatttacatttatttcctnnnnnnnnnnnnnnnnngagaataattacattatacagaaccttgctatatggtg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31645060 |
cttggatacacacaatgcaactaagaatatttacatttatttcctaaaaaaaaataaaaaaagagaataattacattatacagaaccttgctatatggtg |
31645159 |
T |
 |
| Q |
209 |
aacaggtgg |
217 |
Q |
| |
|
||||||||| |
|
|
| T |
31645160 |
aacaggtgg |
31645168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 217 - 246
Target Start/End: Original strand, 31645183 - 31645212
Alignment:
| Q |
217 |
gatagagaaaggcatcattcactttgaggt |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
31645183 |
gatagagaaaggcatcattcactttgaggt |
31645212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University