View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6353_high_12 (Length: 338)
Name: NF6353_high_12
Description: NF6353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6353_high_12 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 15 - 338
Target Start/End: Complemental strand, 37846247 - 37845928
Alignment:
| Q |
15 |
gatagagggaaggtaaatcaaacaaggctgggaataggttatttttggaacaattagagcagctaccaccactgttttaacctctgtctcacaatttccc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37846247 |
gatagagggaaggtaaatcaaacaaggctgggaataggttatttttggaacaattagagcagctaccaccactgttttaacctctgtctcacaatttccc |
37846148 |
T |
 |
| Q |
115 |
attagttgaattacaagtccatggataccaactgcaggtctagctagacatgagtttccaatcatcccaatcatagactcccagtggaaatttatccgca |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37846147 |
attagttgaattacaagtccatggataccaactgcaggtctag----acatgagtttccaatcatcccaatcatagactcccagtggaaatttatccgca |
37846052 |
T |
 |
| Q |
215 |
tcttgccaaaatccaaattcactattatctggaggttcggtatccacattaaatgtaacttttccatggagatggtcgtcaatactaacaactggaacat |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37846051 |
tcttgccaaaatccaaagtcactattatctcgaggttcggcatccacattaaatgtaacttttccatggagatggtcgtcaatactaacaactggaacat |
37845952 |
T |
 |
| Q |
315 |
cagagaaaatattacaagtactac |
338 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37845951 |
cagagaaaatattacaagtactac |
37845928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University