View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6353_low_20 (Length: 240)
Name: NF6353_low_20
Description: NF6353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6353_low_20 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 35619362 - 35619580
Alignment:
| Q |
4 |
cttcgtcattgtcatgcctcgaaatgctcctcccgtcgttactccgttaccggctccgacggatctctcacaaaatccgttctatattcatccttctgaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35619362 |
cttcgtcattgtcatgcctcgaaatgctcctcccgtcgttactccgttaccggctccgacggatctctcacaaaatccgttctatattcatccttctgaa |
35619461 |
T |
 |
| Q |
104 |
aatcctttaaatggattggggcaagaattacaatcactcaacaatgtgattacctatatcactcaacaattaagccaacttctcagcaaacctacacaaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35619462 |
aatcctttaaatggattggggcaagaattacaatcactcaacaatgtgattacctatatcactcaacaattaagccaacttctcagcaaacctacacaaa |
35619561 |
T |
 |
| Q |
204 |
ctcattataatgcagctat |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35619562 |
ctcattataatgcagctat |
35619580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University