View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6353_low_28 (Length: 213)
Name: NF6353_low_28
Description: NF6353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6353_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 13287713 - 13287914
Alignment:
| Q |
1 |
aattagttgaaggttgtacctatggttttcctgtagactttgtagttgttgccttaaaatctcagcctccctttgccaaaactatcagttagttatcaag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||| ||||||||||||||||| ||||||||||| || ||||||||||||||||||||| |||| |||||| |
|
|
| T |
13287713 |
aattagttgaaggttttacctatggttttcttgtagactttgtagttgctgccttaaaatgtctgcctccctttgccaaaactatgagtt----atcaag |
13287808 |
T |
|
| Q |
101 |
taaaataatgtcaatggttaatgaaaaggaaacaaaatgtgattggctgatattcaactggacctactatcagatatgaaatgtgaatcacagtaatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13287809 |
taaaataatgtcaatggttaatgaaacggaaagaaaatgtgattggctgatattcaactgaacctactatcagatatgaaatgtgaatcacagtaatttt |
13287908 |
T |
|
| Q |
201 |
atgatg |
206 |
Q |
| |
|
|||||| |
|
|
| T |
13287909 |
atgatg |
13287914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University