View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_high_24 (Length: 297)
Name: NF6355_high_24
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_high_24 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 19 - 279
Target Start/End: Original strand, 6868357 - 6868617
Alignment:
| Q |
19 |
ggagaatcataactaacgtcggaacggatttgaacggtggttttggataagggtgatttgtgtttgggggtatttgagattgggaggaagtggttttgat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
6868357 |
ggagaatcataactaacgtcggaacggatttgaacggtggttttggataagggtgatttgtgtttgggggtatttgagattgggaggaagtgggtttgat |
6868456 |
T |
|
| Q |
119 |
ggagaagtggttttttagagaagctggtttgagtaggttgtgagtgtaaggaagaaacgttgccgttgagaagagaagccatagagataatttgtttggt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
6868457 |
ggagaagtggttttttagagaagctggtttgagtaggttgtgagtgtaaggaagaaacgttgccgttgagaagagaagccatagaggaaattggtttggt |
6868556 |
T |
|
| Q |
219 |
ggagtatgcaaagtgattatgtggtgtgtttaataatggttgtgtataagttcagcccttc |
279 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6868557 |
ggagtatgcaaagtgattatgtggtgtgtttaataatggttgtgtataagttcagcccttc |
6868617 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 28 - 200
Target Start/End: Complemental strand, 14080394 - 14080228
Alignment:
| Q |
28 |
taactaacgtcggaacggatttgaacggtggttttggataagggtgatttgtgtttgggggtatttgagattgggaggaagtggttttgatggagaagtg |
127 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||| |||||||| ||||||||||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
14080394 |
taactaacgtctgaacggattttaacggt---tttggataacggtgatttttgtttgggggtttttgagattggga---agtgggtttgatggagaagtg |
14080301 |
T |
|
| Q |
128 |
gttttttagagaagctggtttgagtaggttgtgagtgtaaggaagaaacgttgccgttgagaagagaagccat |
200 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14080300 |
ctttttttgagaagctggtttgagtgggttgtgggtgtaaggaagaaacgctgccgttgagaagagaagccat |
14080228 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 28 - 200
Target Start/End: Complemental strand, 14390422 - 14390256
Alignment:
| Q |
28 |
taactaacgtcggaacggatttgaacggtggttttggataagggtgatttgtgtttgggggtatttgagattgggaggaagtggttttgatggagaagtg |
127 |
Q |
| |
|
||||||||||| |||||||||| |||||| ||||||||| |||||||| ||||||||||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
14390422 |
taactaacgtctgaacggattttaacggt---tttggataacggtgatttttgtttgggggtttttgagattggga---agtgggtttgatggagaagtg |
14390329 |
T |
|
| Q |
128 |
gttttttagagaagctggtttgagtaggttgtgagtgtaaggaagaaacgttgccgttgagaagagaagccat |
200 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14390328 |
ctttttttgagaagctggtttgagtgggttgtgggtgtaaggaagaaacgctgccgttgagaagagaagccat |
14390256 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 14080121 - 14080083
Alignment:
| Q |
240 |
tggtgtgtttaataatggttgtgtataagttcagccctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14080121 |
tggtgtgtttaataatggttgtgtataagttcaaccctt |
14080083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 278
Target Start/End: Complemental strand, 14390149 - 14390111
Alignment:
| Q |
240 |
tggtgtgtttaataatggttgtgtataagttcagccctt |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14390149 |
tggtgtgtttaataatggttgtgtataagttcaaccctt |
14390111 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University