View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_high_33 (Length: 245)
Name: NF6355_high_33
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_high_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 18 - 236
Target Start/End: Complemental strand, 35213530 - 35213312
Alignment:
| Q |
18 |
gagaaatgtgttaaaaatgaaggttgagtcagttggaaacccttaaaaaattgccaaatgccaactacatttatggcaaacaaaataatgaggaaacaat |
117 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35213530 |
gagaaatgtgtaaaaaatgaaggttgagtcagttggaaacccttaaaaaattgccaaatgccaactacatttatggcaaacaaaataatgaggaaacaat |
35213431 |
T |
 |
| Q |
118 |
caaatcttcaccatcagagattgacaagatgagaaatcactttcagaaaatgacaacaagatgagtaagaccacccttgcccaatctgagtactacgaca |
217 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
35213430 |
caaatcttcatcatcagagattgacaagatgagaaatcactttcagaaaatgacaacaagatgagtaagaccacccttgcccaatccgagtactaagaca |
35213331 |
T |
 |
| Q |
218 |
gtaaaacttggtgcatctc |
236 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
35213330 |
gtaaaacttggtgcatctc |
35213312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University