View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_high_39 (Length: 228)
Name: NF6355_high_39
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_high_39 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 7 - 202
Target Start/End: Original strand, 6990961 - 6991156
Alignment:
| Q |
7 |
ctttgctcattgaattgctacgctacaaggtttaggcatcattatcaacaacagtcaacacggtaaaacacccttcacgtgatttgcttgtgccgtccac |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6990961 |
ctttgctcattgaattgctacgctacaaggtttaggtatcattatcaacaacagtcaacacggtaaaacacccttcacgtgatttgcttgtgccatccac |
6991060 |
T |
 |
| Q |
107 |
cacttcatgttttcacctaataatagatttataaatgatacaattcatgtttgaattttaaaagtaagatgttagtttaatatttactctttagtc |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6991061 |
cacttcatgttttcccctaataatagatttataaatgatacaattcatgtttgaattttaaaagtaagatgttagtttaatatttactctttagtc |
6991156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University