View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF6355_high_7 (Length: 448)
Name: NF6355_high_7
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF6355_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 251 - 432
Target Start/End: Original strand, 47150653 - 47150834
Alignment:
| Q |
251 |
cttttcctcgccctctatagctagcatttccaatttcatttgtctcaataaagagaagcattatgcttttatggagcatttcatttcacaaatgaattga |
350 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150653 |
cttttcctcgccctctatagctagcatttccaatttcatttgtctcaataaagagaagcattatgcttttatggagcatttcatttcacaaatgaattga |
47150752 |
T |
 |
| Q |
351 |
agtaatagatctcatatatctaacatggctcaacaacactataacccaatattacttttggatacgttgtactgttcagaag |
432 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150753 |
agtaatagatctcatatatctaacatggctcaacaacactataacccaatattacttttggatacgttgtactgttcagaag |
47150834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 145; E-Value: 4e-76
Query Start/End: Original strand, 43 - 191
Target Start/End: Original strand, 47150434 - 47150582
Alignment:
| Q |
43 |
tgatctttatgatgattgatcttttaaaattgacgattgaaagaccgcgaaatggatagggatccttaaatcgtagggtacaattggtcacgtgtcgagt |
142 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150434 |
tgatctttatgattattgatcttttaaaattgacgattgaaagaccgcgaaatggatagggatccttaaatcgtagggtacaattggtcacgtgtcgagt |
47150533 |
T |
 |
| Q |
143 |
aaataggacccatggtccatatgattcattcatcttcaaggctagctag |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47150534 |
aaataggacccatggtccatatgattcattcatcttcaaggctagctag |
47150582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University