View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF6355_low_25 (Length: 296)

Name: NF6355_low_25
Description: NF6355
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF6355_low_25
NF6355_low_25
[»] chr4 (2 HSPs)
chr4 (15-279)||(6092990-6093254)
chr4 (33-66)||(4514119-4514152)


Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 279
Target Start/End: Complemental strand, 6093254 - 6092990
Alignment:
15 tatacttaatgattgataatttaatatgggacctgaaaaagtttacatttattttaactacagttaatgattagtaaccttactttttcgaaattgttta 114  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
6093254 tatacttaatgattgataatttaatatgggacctgaaaaagtttacatttattttaactacagttaatgattagtaaccttacttttttgaaattgttta 6093155  T
115 tttcacttcttgttggatnnnnnnnnnnnnnnnnnnnnnnggtggaacatgtcatgtaaacctcgtaaagagagattgatgaggctcccaaaagaggttt 214  Q
    ||||||||||||||||||                      ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6093154 tttcacttcttgttggataaaaataataaaaaatgaaaaaggtggaacatgtcatgtaaacctcgtaaagagagattgatgaggctcccaaaagaggttt 6093055  T
215 tggggtttggagggatgagtgttgagaagggtaaaatcagcctttctttcttctttggttagtct 279  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6093054 tggggtttggagggatgagtgttgagaagggtaaaatcagcctttctttcttctttggttagtct 6092990  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 33 - 66
Target Start/End: Complemental strand, 4514152 - 4514119
Alignment:
33 atttaatatgggacctgaaaaagtttacatttat 66  Q
    ||||||||||||||||||||||||| ||||||||    
4514152 atttaatatgggacctgaaaaagttaacatttat 4514119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University